In this investigation, students amplify various segments of the bacteriophage lambda genome, then electrophorese and analyze the PCR samples. Students use the sizes of the PCR products generated by the three different forward primers and one reverse primer, provided, to map the locations of the primers relative to one another in the bacteriophage lambda genome. You will get enough materials to run up to 24 PCR reactions, as well as a teacher’s guide and student copymaster. Note: Coupon included for perishable materials. Redeem by mail, fax, phone, or e-mail. Ethidium bromide version sold only to colleges, universities, and accredited laboratories. Check your local regulations for disposal of ethidium bromide.
Materials Included
•1 Sterile Mineral Oil, 5 mL
•1 Sterile Water, 5 mL
•1 TBE Running Buffer 5X, 500 mL
•1 Vial of Loading Dye, 0.5 mL
•1 Agarose Gel, 2%, 200 mL
•24 Plastic Reaction Tubes, 0.5 mL
•1 Floating Rack
•1 Bottle WARD’S QUIKView DNA Stain Concentrate, 60 mL (36 W 8857)
•1 Tube Ethidium Bromide DNA Stain, 50 ?L, (10 mg/mL) (36 W 9957)
•1 Amber bottle, 500 mL, labeled for 1X Ethidium Bromide (36 W 9957)
•1 Biohazard bag (36 W 9957)
•Coupon for perishable material: 2 Hae III Digest of ?X174 DNA Marker Standard, 40 ?L, 1 PCR Master Mix, 600 ?L, 1 PCR Master Mix, 600 ?L, 1 Primer F1, 60 ?L (5’ CAAAAAGAACTTCCTGCCGGAC 3`), 1 Primer F2, 60 ?L (5’ GATGAGTTCGTGTCCGTACAAC 3`), 1 Primer F3, 60 ?L (5’ ATGAAACTGCCGGTCAGGACAC 3`), 1 Primer R1, 180 ?L (5’ GGTTATCGAAATCAGCCACAG 3`), 1 Lambda DNA, 120 ?L
Materials Needed But Not Provided
•Electrophoresis Chamber
•Power Supply
•Water Bath or Thermal Cycler
•Micropipets
•Marking Pens
•Timer
•UV Transilluminator (36 W 9957)
•UV Goggles (36 W 9957)
•Ice
Time Requirement
•One two-hour lab period or two 45-minute lab periods
|
