Throughout evolution, segments of DNA about 300 bp long have been interspersed among primate genomes. Alu genotype distribution varies among different populations; anywhere from 500,000 to 1 million copies may reside in the human genome. The insert is often used in genetic and evolutionary studies. Students use polymerase chain reaction technology to amplify segments of real human DNA and then electrophorese them to determine the Alu genotype. You will get enough materials to run 24 PCR reactions, a teacher’s guide, and student copymaster. Note: Coupon included for perishable materials. Redeem by mail, fax, phone, or email. Ethidium bromide version sold only to colleges, universities, and accredited laboratories. Check your local regulations for disposal of ethidium bromide.
Materials Included •1 Lysis Buffer, 15 mL •1 Agarose, 2%, 200 mL •4 Gel staining trays •1 10% Chelex in sterile water, 5 mL •1 Sterile Mineral Oil, 5 mL •1 Sterile Water, 5 ml •24 Plastic PCR Reaction Tubes, 0.5 mL •30 DNA Isolation Tubes, 1.5 mL •24 Sterile Cotton Swabs •1 Floating Rack •1 Loading Dye (10X), 0.5 mL •1 TBE Buffer (5X), 500 mL •1 Bottle WARD’S QUIKView DNA Stain Concentrate, 60 mL (36 W 8859) •1 Tube Ethidium Bromide DNA Stain, 50 ?L, (10 mg/mL) (36 W 9959) •1 Biohazard bag (36 W 9959) •1 Coupon for perishable material: 2 Hae III Digest of ?X174 DNA Marker Standard, 40 ?L, 1 PCR Master Mix, 600?L, 1 Primer A (5` GTAAGAGTTCCGTAACAGGACAG 3`), 1 Primer B (5`CCCCACCCTAGGAGAACTTCTTT 3`), 2 Allele Samples: Allele #1 (with Alu insertion — 400 bp), 60 ?L, Allele #2 (without Alu insertion — 100 bp), 60 ?L
Materials Needed But Not Provided •Programmable Thermal Cycler •Electrophoresis Chamber •Power Supply •Microcentrifuge •Micropipets •Marking Pens •Boiling water bath or microwave •Timer •Ice •Gloves •goggles •aprons •UV transilluminator (36 W 9959) •UV goggles (36 W 9959)
Time Requirement •Three or four 50-minute periods, depending on options chosen and equipment available
|