Your Shopping Cart:
Your Cart Contains 0 Items
Total $0.00

100% SECURE SHOPPING


Biology Geology Chemistry Physical
Science
Environmental
Science
Forensics Lab
Supplies


November 21, 2009

  


Sign-up and get special offers, sales & discounts

See current email promotion. Click here

Ag and Vet Science
AP* Science
AV Equipment
AV Materials
Biology
Books
Charts, Maps, and Posters
Chemicals
Chemistry
Classroom and General Supplies
Clearance Sale
Collector's Corner
Computer Software
Earth Science
Environmental Science
Field Equipment
Forensic Science
Furniture
Lab Equipment and Supplies
Microscopes
Nursing
Optical Equipment
Physical Science
Probeware


New Products
Web Specials
Live Coupon Redemption
Professional Development
International Customers
Homeschool Science
GLOBE Program


Customer Service
Technical Service
Request a Catalog
Refer a Friend
Teacher Resources
Guarantee
Find Your Sales Manager
About WARD's
Careers at WARD's
Summer Jobs





Products

WARD’S Detection of Alu Insertion by PCR Lab Activity

Examine Individual Genotypes for a DNA Polymorphism Found in the Human Genome
Throughout evolution, segments of DNA about 300 bp long have been interspersed among primate genomes. Alu genotype distribution varies among different populations; anywhere from 500,000 to 1 million copies may reside in the human genome. The insert is often used in genetic and evolutionary studies. Students use polymerase chain reaction technology to amplify segments of real human DNA and then electrophorese them to determine the Alu genotype. You will get enough materials to run 24 PCR reactions, a teacher’s guide, and student copymaster. Note: Coupon included for perishable materials. Redeem by mail, fax, phone, or email. Ethidium bromide version sold only to colleges, universities, and accredited laboratories. Check your local regulations for disposal of ethidium bromide.

Materials Included
•1 Lysis Buffer, 15 mL
•1 Agarose, 2%, 200 mL
•4 Gel staining trays
•1 10% Chelex in sterile water, 5 mL
•1 Sterile Mineral Oil, 5 mL
•1 Sterile Water, 5 ml
•24 Plastic PCR Reaction Tubes, 0.5 mL
•30 DNA Isolation Tubes, 1.5 mL
•24 Sterile Cotton Swabs
•1 Floating Rack
•1 Loading Dye (10X), 0.5 mL
•1 TBE Buffer (5X), 500 mL
•1 Bottle WARD’S QUIKView DNA Stain Concentrate, 60 mL (36 W 8859)
•1 Tube Ethidium Bromide DNA Stain, 50 ?L, (10 mg/mL) (36 W 9959)
•1 Biohazard bag (36 W 9959)
•1 Coupon for perishable material: 2 Hae III Digest of ?X174 DNA Marker Standard, 40 ?L, 1 PCR Master Mix, 600?L, 1 Primer A (5` GTAAGAGTTCCGTAACAGGACAG 3`), 1 Primer B (5`CCCCACCCTAGGAGAACTTCTTT 3`), 2 Allele Samples: Allele #1 (with Alu insertion — 400 bp), 60 ?L, Allele #2 (without Alu insertion — 100 bp), 60 ?L

Materials Needed But Not Provided
•Programmable Thermal Cycler
•Electrophoresis Chamber
•Power Supply
•Microcentrifuge
•Micropipets
•Marking Pens
•Boiling water bath or microwave
•Timer
•Ice
•Gloves
•goggles
•aprons
•UV transilluminator (36 W 9959)
•UV goggles (36 W 9959)

Time Requirement
•Three or four 50-minute periods, depending on options chosen and equipment available



Item #DescriptionPriceQty 

36 V 8859Restricted Item WARD’S Detection of Alu Insertion by PCR Lab Activity
$179.00
Temporarily Out of Stock


(0 customer reviews)

and share your thoughts with other customers
 
Edmund Scientific

X-Treme Geek



 

HomeSite MapOrder a CatalogTerms & ConditionsPrivacy Policy
HelpContact UsGuaranteesTerms of UseFAQ

© 2008 WARD'S Natural Science • PO Box 92912 • Rochester, NY • 14692-9012 • 800-962-2660
 
::adCenter::